It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Haplogroup G (M201) is a human Y-chromosome haplogroup. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. Concerning the presence of hg G in the Caucasus, one of its distinguishing features is lower haplogroup diversity in numerous populations (Supplementary Table S1) compared with Anatolia and Armenia, implying that hg G is intrusive in the Caucasus rather than autochthonous. Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. In Russia, Ukraine and Central Asia, members of various ethnic minorities and/or residents in particular localities possess G-M201 at its highest levels in the world even though the average rate at the national level is about 1% or less. It encompasses a small group of Hispanic men who also so far all have the odd value of 13,21 at the YCA marker. ), Haplogroup M, as of 2017, is also known as K2b1b. Haplogroup G represents one of the first peoples in Europe. L2b1a. Science 2000; 290: 11551159. Haplogroup | Your past through your genes [25], In the Middle East, haplogroup G accounts for about 3% of the population in almost all areas. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. These Neolithic European were descendants of Neolithic farmers from Anatolia, among some of the earliest peoples in the world to practice agriculture. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. Included within G-L91 are some men with double values for STR marker DYS19, but there are also G2a2 men with this finding who are not L91+. Am J Hum Genet 2004; 74: 788788. Please help update this article to reflect recent events or newly available information. Achilli A, Olivieri A, Pala M et al. The Network 4.6.0.0 (Fluxus-Engineering) program was used (median-joining algorithm and the post-processing option). Differential Y-chromosome Anatolian influences on the Greek and Cretan Neolithic. Y-DNA haplogroups are useful to determine whether two apparently unrelated individuals sharing the same surname do indeed descend from a common ancestor in a not too distant past (3 to 20 generations). The DYS391 marker has mostly a value of 10, but sometimes 11, in G2a2b1 persons, and DYS392 is almost always 11. In contrast to G1, the absolute majority of hg G samples belonged to G2-P287-related sub-clades, with the vast majority of them being associated with G2a-P15-related lineages. However, interpretations based on coarse haplogroup resolution frequency clines are unsophisticated and do not recognize underlying patterns of genetic diversification. This video explains the migration route of Y-chromosome haplogroup G and the countries where it can be found today. PLoS One 2011; 6: e20232. In contrast, the only U1 representative in Europe is the G-M527 lineage whose distribution pattern is consistent with regions of Greek colonization. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. The authors declare no conflict of interest. Interestingly, the L30 SNP, phylogenetically equivalent to M485, M547 and U8, was detected in an approximately 7000-year-old Neolithic specimen from Germany, although this ancient DNA sample was not resolved further to additional sub-clade levels.39. PLoS One 2009; 4: e5792. It is a branch of Haplogroup F (M89), and is theorized to have originated, according to the latest thinking, in the Near East or Southern Asia, likely in the region that is now northern India, Pakistan, and Afghanistan. Capelli C, Brisighelli F, Scarnicci F, Blanco-Verea A, Brion M, Pascali VL : Phylogenetic evidence for multiple independent duplication events at the DYS19 locus. Taken as a collective group, P303-derived chromosomes are the most widespread of all hg G lineages (Supplementary Table S1 and Figure 2b) and clearly display differential geographic partitioning between L497 (Figure 2c) and U1 (xM527) (Figure 2d). Use the Previous and Next buttons to navigate the slides or the slide controller buttons at the end to navigate through each slide. PubMedGoogle Scholar. P15 was identified at the University of Arizona and became widely known by 2002. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Y-chromosomal diversity in Europe is clinal and influenced primarily by geography, rather than by language. Haplogroup LT (L298/P326) is also known as Haplogroup K1. In the Russian North Caucasus the Kabardinian and Ossetian populations are also notable for high rates of G-M201. Mol Phylogenet Evol 2007; 44: 228239. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. [21] In a study of 936 Indians, haplogroup G made up less than 1% of the sample and was completely absent in the tested Northwestern Indian population. Kharkov VN, Stepanov VA, Borinskaya SA et al. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. The M527-defined sub-clade is unusual in that it reflects the presence of hg G-U1 that is otherwise rare in Europe. Among Turkish males 11% of the population is G.[6] In Iran, Haplogroup G reaches 13 to 15% of the population in various parts of the country. Pichler I, Fuchsberger C, Platzer C et al. Haplogroup G-M285 - Wikipedia It has been found in Mexican mestizos. G2a2b1 is more common in southern Europe than northern Europe. Distribution. Almost all haplogroup G1 persons have the value of 12 at short tandem repeat (STR) marker DYS392 and all will have the M285 or M342 SNP mutation which characterizes this group. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Haplogroup G1 is a primary subclade of haplogroup G . The emergence of Y-chromosome haplogroup J1e among Arabic-speaking populations. IK thanks the Russian Foundation for Basic Research for grant 08-06-97011 and the Grant of the President of the Russian Federation of state support for young Russian scientists MK-488.2006.4. The genetic variation in the R1a clade among the Ashkenazi - Nature We attempted to localize the potential geographic origin of haplogroup G-M201 by considering those locations containing both G1-M285- and G2-P287-related lineages as well as the co-occurrence of high sub-haplogroup diversity. Y-chromosome lineages from Portugal, Madeira and Acores record elements of Sephardim and Berber ancestry. G2a was found also in 20 out of 22 samples of ancient Y-DNA from Treilles, the type-site of a Late Neolithic group of farmers in the South of France, dated to about 5000 years ago. Haplogroup G (Y-DNA) In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup. The haplogroups contain many branches called subhaplogroups or subclades. Sims LM, Garvey D, Ballantyne J : Improved resolution haplogroup G phylogeny in the Y chromosome, revealed by a set of newly characterized SNPs. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. The next largest subclade of G-P303 is characterized by the presence of the U1 mutation. [20] The city is on the banks of the river Drava, which notably begins in the Tirol/Tyrol region of the Alps, another haplogroup G focus area in Europe. Its identification caused considerable renaming of G categories. (a)(f) Spatial frequency maps of haplogroup G (hg G) and its sub-clades with frequencies over 10%. While acknowledging that the inference of the age and geographic source of dispersals of Y chromosome haplogroups from the frequency and STR diversity data can be approximate at best, we speculate that this lineage could potentially be associated with the Linearbandkeramik (LBK) culture of Central Europe, as its highest frequency (3.45.1%) and Td estimate (Supplementary Table S4) of 108703029 years ago occur there. Haplogroup G2a1 (also known as G-FGC753 and previously as G-L293) and its subclades represent the majority of haplogroup G samples in some parts of the Caucasus Mountains area. Considering these issues, we acknowledge that the variance of the age estimates may be underestimated. L141 persons who do not belong to any L141 subclade so far have the value of 11 at STR marker DYS490 a finding rare in other G categories. King RJ, DiCristofaro J, Kouvatsi A et al. The network was obtained using the biallelic markers P303, M426, L497, U1, M527 and 19 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461 (TAGA counts), DYS385a,b, DYS437, DYS438, DYS448, DYS456, DYS458, DYS635, YGATAH4). The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. (2004) Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the . Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. The G-P303 phylogenetic network was constructed using 248 G2a3b-P303-derived 19-locus haplotypes from populations representing Europe, Middle/Near East, South/Central Asia and the Caucasus and belonging to five sub-clades P303*, U1, M527, M426 and L497. Semino et al. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. Martinez L, Underhill PA, Zhivotovsky LA et al. Nonetheless, coalescent times provide a valuable/informative relative metric for estimating the time of lineage formation. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. G-M201 has also been found in Neolithic Anatolian sites such as Boncuklu dating back to 8300-7600 BCE, and Barcin dating back to 6419-6238 BCE. PLoS One 2011; 6: e17548. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. You are using a browser version with limited support for CSS. Excavating Y-chromosome haplotype strata in Anatolia. The coming of the Greeks to Provence and Corsica: Y-chromosome models of archaic Greek colonization of the western Mediterranean. The identification of a new SNP can necessitate renaming of one or more categories. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. Herein . Circles represent microsatellite haplotypes, the areas of the circles and sectors are proportional to haplotype frequency (smallest circle corresponds to one individual) and the geographic area is indicated by color. [38][self-published source?] (2000) suggested 17,000 years ago. It is not found among Native Americans except where intermarriage with non-native persons has occurred. The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. The Sea Peoples, from cuneiform tablets to carbon dating. A more compact cluster of Near/Middle Eastern samples is also resolved in the network. Another notable feature is its uneven distribution. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. White PS, Tatum OL, Deaven LL, Longmire JL : New, male-specific microsatellite markers from the human Y chromosome. The Etruscans: a population-genetic study. G-CTS2488 or G2a2b2 (also known as G-L141.1; previously G-141 and G2a3b) was identified only in mid-2009 at Family Tree DNA. The L141 mutation involves an insertion.[35]. There are seeming pockets of unusual concentrations within Europe. The presence of the SNP P18 mutation characterizes G2a1a's only subclade, G2a1a. Croat Med J 2005; 46: 502513. G2a was found in medieval remains in a 7th- century CE high-status tomb in Ergolding, Bavaria, Germany, but G2a subclades were not tested.[34]. ), Ancient G-M201s with sequencing[self-published source?] Hum Genet 2009; 126: 707717. (a) Principal component analysis by population. Eur J Hum Genet 2008; 16: 374386. Ann Hum Genet 2005; 69: 443454. Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. G2a3a-M406 has a modest presence in Thessaly and the Peloponnese (4%),10 areas of the initial Greek Neolithic settlements. In 2012, SNPs with the Z designation as first identified by citizen researchers from 1000 Genomes Project data began to appear. Google Scholar. Spatial frequency maps for sub-clades (panels bf) were obtained by applying the frequencies from Supplementary Table S1 using the Surfer software (version 8, Golden Software, Inc.), following the kriging algorithm with option to use bodies of water as breaklines. Spatial autocorrelation analysis was carried out to assess the presence/absence of clines regarding informative G sub-haplogroups. Semino et al.
Federal Screw Works Annual Report,
Can Medical Assistants Give Injections In California,
Plymouth Township Mi Police Scanner,
How To Disable 2fa On Discord Without Logging In,
Articles H
